WormMine: Gene WBGene00032909

• WormBase Gene ID: WBGene00032909
• Gene Name: Cbr-pbrm-1
• Sequence Name: CBG11867
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable chromatin binding activity. Predicted to be involved in chromatin remodeling. Predicted to be part of RSC-type complex. Is an ortholog of C. elegans pbrm-1. In C. elegans, pbrm-1 is involved in gonad development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11867.1	CBG11867.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11867	CBG11867		[unknown]

0 RNAi Result

9 Allele

• WBVar00117969
• WBVar00117966
• WBVar00117965
• WBVar00117968
• WBVar00117967
• WBVar00117971
• WBVar00117970
• WBVar00117964
• WBVar00117963

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061613
• Remark: Cbr-pbrm-1, GAAGAAGACGTCACCAAAGCACTGTGGCGGCTACGCGATGAACTTCTGAAGAGCACATGT, WBGene00032909
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region