WormMine: Gene WBGene00032918

• WormBase Gene ID: WBGene00032918
• Gene Name: Cbr-lars-2
• Sequence Name: CBG11879
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; aminoacyl-tRNA editing activity; and leucine-tRNA ligase activity. Predicted to be involved in leucyl-tRNA aminoacylation. Is an ortholog of C. elegans lars-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11879.1	CBG11879.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11879	CBG11879		[unknown]

0 RNAi Result

50 Allele

• WBVar00117988
• WBVar00117987
• WBVar00117989
• WBVar00117995
• WBVar00117994
• WBVar00117997
• WBVar00117996
• WBVar00117991
• WBVar00117990
• WBVar00117993
• WBVar00117992
• WBVar00117977
• WBVar00117979
• WBVar00117978
• WBVar00117984
• WBVar00117983
• WBVar00117986
• WBVar00117985
• WBVar00117980
• WBVar00117982
• WBVar00117981
• WBVar00117999
• WBVar00117998
• WBVar00118000
• WBVar00118006
• WBVar00118005
• WBVar00118008
• WBVar00118007
• WBVar00118002
• WBVar00118001

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1056092
• Remark: Cbr-lars-2, CTGATGATTGACGGCGTCAGTGGAGGACGTCCAAGTGTTGGAAGACAGAAAATTGAAAAT, WBGene00032918
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region