WormMine: Gene WBGene00032961

• WormBase Gene ID: WBGene00032961
• Gene Name: Cbr-unc-15
• Sequence Name: CBG11932
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be part of myosin complex. Is an ortholog of C. elegans unc-15. In C. elegans, unc-15 is involved in several processes, including positive regulation of ovulation; positive regulation of sarcomere organization; and skeletal muscle myosin thick filament assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11932.1	CBG11932.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11932	CBG11932		[unknown]

0 RNAi Result

21 Allele

• WBVar00118049
• WBVar00118048
• WBVar00118064
• WBVar00118063
• WBVar00118066
• WBVar00118065
• WBVar00118060
• WBVar00118062
• WBVar00118061
• WBVar00118068
• WBVar00118067
• WBVar00118053
• WBVar00118052
• WBVar00118055
• WBVar00118054
• WBVar00118051
• WBVar00118050
• WBVar00118057
• WBVar00118056
• WBVar00118059
• WBVar00118058

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1051402
• Remark: Cbr-unc-15, AAGCACTTGTACGAGAAGGCTGTCGAGCAGAAGGAGGCCCTTGCTCGCGAGAACAAAAAG, WBGene00032961
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region