WormMine: Gene WBGene00032964

• WormBase Gene ID: WBGene00032964
• Gene Name: Cbr-unc-13
• Sequence Name: CBG11942
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable diacylglycerol binding activity. Predicted to be involved in chemical synaptic transmission. Is an ortholog of C. elegans unc-13. In C. elegans, unc-13 is involved in regulation of multicellular organismal process; spermatogenesis; and synaptic vesicle exocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11942b.1	CBG11942b.1		[unknown]
Transcript:CBG11942a.1	CBG11942a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11942b	CBG11942b		[unknown]
CDS:CBG11942a	CBG11942a		[unknown]

0 RNAi Result

3 Allele

• WBVar00118071
• WBVar00118070
• WBVar00118069

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067029
• Remark: Cbr-unc-13, AAATGAAGGAGAACCTGAGCACTACGAGCTCATGTTCCAAGTCAAGGACTACTGCTTCGC, WBGene00032964
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region