WormMine: Gene WBGene00033046

• WormBase Gene ID: WBGene00033046
• Gene Name: Cbr-rec-8
• Sequence Name: CBG12032
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in sister chromatid cohesion. Predicted to be part of cohesin complex. Is an ortholog of C. elegans rec-8. In C. elegans, rec-8 is involved in several processes, including meiotic chromosome segregation; meiotic sister chromatid cohesion; and regulation of centriole-centriole cohesion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12032.1	CBG12032.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12032	CBG12032		[unknown]

0 RNAi Result

4 Allele

• WBVar00014277
• WBVar00014272
• WBVar00014267
• WBVar00014262

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1052436
• Remark: Cbr-rec-8, TTTTAGCAAAAGACGCGAAAGACGATGAGTTCGTATTCTTCTCTTCTGGATCCCTTTTAC, WBGene00033046
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region