WormMine: Gene WBGene00033050

• WormBase Gene ID: WBGene00033050
• Gene Name: Cbr-pbs-4
• Sequence Name: CBG12037
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in proteasomal protein catabolic process. Predicted to be part of proteasome core complex. Is an ortholog of C. elegans pbs-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12037.1	CBG12037.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12037	CBG12037		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1062269
• Remark: Cbr-pbs-4, GTGGCCAACATTCCTGGATATAAAGTCGTCATCATTGACAAGAACGGATACCGCAAGCTG, WBGene00033050
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region