WormMine: Gene WBGene00033093

• WormBase Gene ID: WBGene00033093
• Gene Name: Cbr-mrps-6
• Sequence Name: CBG12089
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable rRNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be located in ribosome. Is an ortholog of C. elegans mrps-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12089.1	CBG12089.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12089	CBG12089		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060586
• Remark: CBG12089, TGGGTCATTTCACTCGACAGATGATTTATAAACGAACGGAAAAGGAATGGAAGAGTATTC, WBGene00033093
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region