WormMine: Gene WBGene00033188

• WormBase Gene ID: WBGene00033188
• Gene Name: Cbr-spt-16
• Sequence Name: CBG12204
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be part of FACT complex. Is an ortholog of C. elegans spt-16. In C. elegans, spt-16 is involved in nematode pharynx development; positive regulation of chromosome segregation; and regulation of embryonic development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12204.1	CBG12204.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12204	CBG12204		[unknown]

0 RNAi Result

2 Allele

• WBVar00118371
• WBVar00118370

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058297
• Remark: CBG12204, ATGGTTGCTCAAATTCCGATGAGCAGTATCGACAAGATTAAAGAGTGGCTCCACACTTGT, WBGene00033188
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region