WormMine: Gene WBGene00025899

• WormBase Gene ID: WBGene00025899
• Gene Name: CBG02941
• Sequence Name: CBG02941
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulation of store-operated calcium entry. Predicted to be located in endoplasmic reticulum membrane. Is an ortholog of C. elegans T06D8.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02941b.1	CBG02941b.1		[unknown]
Transcript:CBG02941a.1	CBG02941a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02941a	CBG02941a		[unknown]
CDS:CBG02941b	CBG02941b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065967
• Remark: CBG02941, ATAACCAATATTACGGTCGTAATCGATACAACCGAGGATTTTTCCAAGACACGGGTTTCT, WBGene00025899
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region