WormMine: Gene WBGene00033266

• WormBase Gene ID: WBGene00033266
• Gene Name: Cbr-sup-26
• Sequence Name: CBG12298
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans sup-26. In C. elegans, sup-26 is involved in negative regulation of translation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12298b.1	CBG12298b.1		[unknown]
Transcript:CBG12298c.1	CBG12298c.1		[unknown]
Transcript:CBG12298a.1	CBG12298a.1		[unknown]
Transcript:CBG12298g.1	CBG12298g.1		[unknown]
Transcript:CBG12298d.2	CBG12298d.2		[unknown]
Transcript:CBG12298d.1	CBG12298d.1		[unknown]
Transcript:CBG12298e.1	CBG12298e.1		[unknown]
Transcript:CBG12298f.1	CBG12298f.1		[unknown]
Transcript:CBG12298f.2	CBG12298f.2		[unknown]

Other

7 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12298b	CBG12298b		[unknown]
CDS:CBG12298c	CBG12298c		[unknown]
CDS:CBG12298a	CBG12298a		[unknown]
CDS:CBG12298f	CBG12298f		[unknown]
CDS:CBG12298g	CBG12298g		[unknown]
CDS:CBG12298d	CBG12298d		[unknown]
CDS:CBG12298e	CBG12298e		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060498
• Remark: Cbr-tag-310, ATCCAACGTATGCAATATCCACAAGTCTATCAATCGTACTATGGCTACCCACCAGCCATT, WBGene00033266
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region