WormMine: Gene WBGene00033270

• WormBase Gene ID: WBGene00033270
• Gene Name: Cbr-nth-1
• Sequence Name: CBG12304
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and catalytic activity. Predicted to be involved in base-excision repair. Is an ortholog of C. elegans nth-1. In C. elegans, nth-1 is involved in cellular response to hydrogen peroxide and depyrimidination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12304.1	CBG12304.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12304	CBG12304		[unknown]

0 RNAi Result

7 Allele

• WBVar00039249
• WBVar00039224
• WBVar00039229
• WBVar00039234
• WBVar00039239
• WBVar00039244
• WBVar00118455

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067200
• Remark: Cbr-nth-1, TTGCCGGCTCACTTGTCCCAGTTCGACAGCGAAAACCGGCGAAAAAGTGGAAAAATTGGC, WBGene00033270
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region