WormMine: Gene WBGene00033307

• WormBase Gene ID: WBGene00033307
• Gene Name: Cbr-tlf-1
• Sequence Name: CBG12345
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in DNA-templated transcription initiation. Is an ortholog of C. elegans tlf-1. In C. elegans, tlf-1 is involved in embryo development; positive regulation of protein phosphorylation; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12345a.1	CBG12345a.1		[unknown]
Transcript:CBG12345b.1	CBG12345b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12345a	CBG12345a		[unknown]
CDS:CBG12345b	CBG12345b		[unknown]

0 RNAi Result

2 Allele

• WBVar00014537
• WBVar00014532

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051370
• Remark: Cbr-tlf-1, AAGAAGTTGCTGCAAAGTATCCAGCAGAATCGACGTACGAGCCAGAATTGTCGGTCGGAC, WBGene00033307
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region