WormMine: Gene WBGene00033374

• WormBase Gene ID: WBGene00033374
• Gene Name: CBG12421
• Sequence Name: CBG12421
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity. Predicted to be involved in positive regulation of Rho protein signal transduction. Is an ortholog of C. elegans F36F2.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12421a.2	CBG12421a.2		[unknown]
Transcript:CBG12421a.1	CBG12421a.1		[unknown]
Transcript:CBG12421b.1	CBG12421b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12421a	CBG12421a		[unknown]
CDS:CBG12421b	CBG12421b		[unknown]

0 RNAi Result

19 Allele

• WBVar00037289
• WBVar00037294
• WBVar00118523
• WBVar00118522
• WBVar00118525
• WBVar00118524
• WBVar00118521
• WBVar00118520
• WBVar00118527
• WBVar00118526
• WBVar00118529
• WBVar00118528
• WBVar00118534
• WBVar00118533
• WBVar00118536
• WBVar00118535
• WBVar00118530
• WBVar00118532
• WBVar00118531

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056594
• Remark: CBG12421, ATGATCATGTTATAATCACTCTTCTTCTCGAAGGATCAGAACTAAAGGCGGCTATTCGAG, WBGene00033374
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region