WormMine: Gene WBGene00033391

• WormBase Gene ID: WBGene00033391
• Gene Name: Cbr-mef-2
• Sequence Name: CBG12442
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and protein dimerization activity. Is an ortholog of C. elegans mef-2. In C. elegans, mef-2 is involved in several processes, including receptor guanylyl cyclase signaling pathway; regulation of acetylcholine secretion, neurotransmission; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12442.1	CBG12442.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12442	CBG12442		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055917
• Remark: Cbr-mef-2, TGGACCCGAATGCATATATCAAAGTGGAACCACATTCTCCGCCTCAAAAAAGACCAAGGA, WBGene00033391
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region