WormMine: Gene WBGene00033495

• WormBase Gene ID: WBGene00033495
• Gene Name: Cbr-fars-1
• Sequence Name: CBG12564
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; phenylalanine-tRNA ligase activity; and tRNA binding activity. Predicted to be involved in phenylalanyl-tRNA aminoacylation. Predicted to be located in cytoplasm. Is an ortholog of C. elegans fars-1. In C. elegans, fars-1 is involved in translation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12564b.1	CBG12564b.1		[unknown]
Transcript:CBG12564a.1	CBG12564a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12564a	CBG12564a		[unknown]
CDS:CBG12564b	CBG12564b		[unknown]

0 RNAi Result

2 Allele

• WBVar00118646
• WBVar00118645

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058371
• Remark: Cbr-fars-1, GCAATTCAAGAAGTACAATTTCGAATCACTGGGAGTTGTTCCATCTTCGGGACATCTCCA, WBGene00033495
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region