WormMine: Gene WBGene00033526

• WormBase Gene ID: WBGene00033526
• Gene Name: CBG12604
• Sequence Name: CBG12604
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans K04F10.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12604b.1	CBG12604b.1		[unknown]
Transcript:CBG12604a.1	CBG12604a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12604b	CBG12604b		[unknown]
CDS:CBG12604a	CBG12604a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061259
• Remark: CBG12604, CTGAAGTGCCAAATCGAGCAGCCATTCTTCGTTCTTGGAAAAGGGTGGTGCAGTTGTAAT, WBGene00033526
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region