WormMine: Gene WBGene00033571

• WormBase Gene ID: WBGene00033571
• Gene Name: Cbr-ipgm-1
• Sequence Name: CBG12654
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable manganese ion binding activity and phosphoglycerate mutase activity. Predicted to be involved in glucose catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans ipgm-1. In C. elegans, ipgm-1 is involved in carbohydrate metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12654.1	CBG12654.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12654	CBG12654		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1050870
• Remark: CBG12654, GATCACGGAAATGCCGAGAAGATGAAGGCACCAGATGGTGGAAAGCACACTGCTCACACC, WBGene00033571
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region