WormMine: Gene WBGene00033609

• WormBase Gene ID: WBGene00033609
• Gene Name: Cbr-nekl-2
• Sequence Name: CBG12695
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans nekl-2. In C. elegans, nekl-2 is involved in molting cycle and positive regulation of endocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12695.1	CBG12695.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12695	CBG12695		[unknown]

0 RNAi Result

1 Allele

• WBVar00118781

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067884
• Remark: Cbr-nekl-2, CTTCAACTTGAAAGGGCTTTTGATGGAGAGAATCTCCCGGCACTCGTTATGAAAATTACA, WBGene00033609
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region