WormMine: Gene WBGene00033613

• WormBase Gene ID: WBGene00033613
• Gene Name: Cbr-ckr-1
• Sequence Name: CBG12702
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans ckr-1. In C. elegans, ckr-1 is involved in determination of adult lifespan.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12702a.1	CBG12702a.1		[unknown]
Transcript:CBG12702b.1	CBG12702b.1		[unknown]
Transcript:CBG12702c.1	CBG12702c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12702a	CBG12702a		[unknown]
CDS:CBG12702b	CBG12702b		[unknown]
CDS:CBG12702c	CBG12702c		[unknown]

0 RNAi Result

8 Allele

• WBVar00118787
• WBVar00118786
• WBVar00118789
• WBVar00118788
• WBVar00118783
• WBVar00118785
• WBVar00118784
• WBVar00118790

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065942
• Remark: Cbr-ckr-1, ATGTCAGCTCATTGGCTAATCCAATCACCTACTGTTTCATGAACAAATCATTCCGATCGT, WBGene00033613
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region