WormMine: Gene WBGene00033620

• WormBase Gene ID: WBGene00033620
• Gene Name: Cbr-lbp-6
• Sequence Name: CBG12713
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable lipid binding activity. Is an ortholog of C. elegans lbp-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12713b.1	CBG12713b.1		[unknown]
Transcript:CBG12713c.1	CBG12713c.1		[unknown]
Transcript:CBG12713a.1	CBG12713a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12713a	CBG12713a		[unknown]
CDS:CBG12713b	CBG12713b		[unknown]
CDS:CBG12713c	CBG12713c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1061830
• Remark: Cbr-lbp-6, ACGGAAAGGTCGAGTCAACTATCACTCGTTATATGGAAGGAGACAAGCTCATCACAACTC, WBGene00033620
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region