WormMine: Gene WBGene00033641

• WormBase Gene ID: WBGene00033641
• Gene Name: Cbr-smg-1
• Sequence Name: CBG12735
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Is an ortholog of C. elegans smg-1. In C. elegans, smg-1 is involved in male genitalia development and nuclear-transcribed mRNA catabolic process, nonsense-mediated decay.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12735d.1	CBG12735d.1		[unknown]
Transcript:CBG12735a.1	CBG12735a.1		[unknown]
Transcript:CBG12735b.1	CBG12735b.1		[unknown]
Transcript:CBG12735c.1	CBG12735c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12735d	CBG12735d		[unknown]
CDS:CBG12735a	CBG12735a		[unknown]
CDS:CBG12735b	CBG12735b		[unknown]
CDS:CBG12735c	CBG12735c		[unknown]

0 RNAi Result

1 Allele

• WBVar00014717

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1051233
• Remark: Cbr-smg-1, AGAAGCAACATCATCTGCCAATTTGGCACAAATGTACGAAGGTTGGACAGCTTGGGTCTG, WBGene00033641
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region