WormMine: Gene WBGene00033838

• WormBase Gene ID: WBGene00033838
• Gene Name: Cbr-nfi-1
• Sequence Name: CBG12989
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans nfi-1. In C. elegans, nfi-1 is involved in several processes, including positive regulation of transcription by RNA polymerase II; regulation of egg-laying behavior; and regulation of nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12989f.1	CBG12989f.1		[unknown]
Transcript:CBG12989c.1	CBG12989c.1		[unknown]
Transcript:CBG12989b.1	CBG12989b.1		[unknown]
Transcript:CBG12989e.1	CBG12989e.1		[unknown]
Transcript:CBG12989d.1	CBG12989d.1		[unknown]
Transcript:CBG12989a.1	CBG12989a.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12989f	CBG12989f		[unknown]
CDS:CBG12989e	CBG12989e		[unknown]
CDS:CBG12989b	CBG12989b		[unknown]
CDS:CBG12989a	CBG12989a		[unknown]
CDS:CBG12989d	CBG12989d		[unknown]
CDS:CBG12989c	CBG12989c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060980
• Remark: Cbr-nfi-1, CACCACCACACGCAGCAGTATCCAATTTGATTAGTCGAGAAAGTAACGGTTTCATGGGTA, WBGene00033838
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region