WormMine: Gene WBGene00033891

• WormBase Gene ID: WBGene00033891
• Gene Name: Cbr-kcc-3
• Sequence Name: CBG13060
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in monoatomic ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans kcc-3. In C. elegans, kcc-3 is involved in microvillus organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13060.1	CBG13060.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13060	CBG13060		[unknown]

0 RNAi Result

11 Allele

• WBVar00119297
• WBVar00119298
• WBVar00119295
• WBVar00119296
• WBVar00119293
• WBVar00119294
• WBVar00058074
• WBVar00058079
• WBVar00058069
• WBVar00026669
• WBVar00026674

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050807
• Remark: Cbr-kcc-2, ATCGGAGGATATGAAAGCAGGACTTCAGAAGTACATCTACATGTTACGAATTGACGCAGA, WBGene00033891
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region