WormMine: Gene WBGene00033904

• WormBase Gene ID: WBGene00033904
• Gene Name: Cbr-fust-1
• Sequence Name: CBG13075
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans fust-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13075c.1	CBG13075c.1		[unknown]
Transcript:CBG13075d.1	CBG13075d.1		[unknown]
Transcript:CBG13075a.1	CBG13075a.1		[unknown]
Transcript:CBG13075b.1	CBG13075b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13075c	CBG13075c		[unknown]
CDS:CBG13075b	CBG13075b		[unknown]
CDS:CBG13075a	CBG13075a		[unknown]
CDS:CBG13075d	CBG13075d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064613
• Remark: CBG13075, ACGCGGTGGTGGTGGAAATGCCAATATGGAGCAAAGAAAGAATGACTGGCCATGTGATCA, WBGene00033904
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region