WormMine: Gene WBGene00033933

• WormBase Gene ID: WBGene00033933
• Gene Name: Cbr-aqp-1
• Sequence Name: CBG13111
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable channel activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans aqp-1. In C. elegans, aqp-1 is involved in defense response to Gram-negative bacterium; glycerol transmembrane transport; and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13111a.1	CBG13111a.1		[unknown]
Transcript:CBG13111b.1	CBG13111b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13111b	CBG13111b		[unknown]
CDS:CBG13111a	CBG13111a		[unknown]

0 RNAi Result

6 Allele

• WBVar00137679
• WBVar00137681
• WBVar00137680
• WBVar00137683
• WBVar00137682
• WBVar00137684

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059227
• Remark: Cbr-aqp-1, ATATCCAATCAATCCAGCAAGAGATCTAGGACCACGACTTTTCAGTTATTTCATCTACGG, WBGene00033933
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region