WormMine: Gene WBGene00033944

• WormBase Gene ID: WBGene00033944
• Gene Name: Cbr-cul-4
• Sequence Name: CBG13132
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ubiquitin protein ligase binding activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Is an ortholog of C. elegans cul-4. In C. elegans, cul-4 is involved in proteasome-mediated ubiquitin-dependent protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13132.1	CBG13132.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13132	CBG13132		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065684
• Remark: Cbr-cul-4, GCAGCAGATATCAAGAAACGTATCGAAGGACTCATCGAGCGTGATTACATCTCTCGTGAT, WBGene00033944
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region