WormMine: Gene WBGene00034037

• WormBase Gene ID: WBGene00034037
• Gene Name: Cbr-crh-1
• Sequence Name: CBG13248
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans crh-1. In C. elegans, crh-1 is involved in several processes, including dauer entry; determination of adult lifespan; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13248f.1	CBG13248f.1		[unknown]
Transcript:CBG13248e.1	CBG13248e.1		[unknown]
Transcript:CBG13248d.1	CBG13248d.1		[unknown]
Transcript:CBG13248c.1	CBG13248c.1		[unknown]
Transcript:CBG13248b.1	CBG13248b.1		[unknown]
Transcript:CBG13248a.1	CBG13248a.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13248a	CBG13248a		[unknown]
CDS:CBG13248b	CBG13248b		[unknown]
CDS:CBG13248c	CBG13248c		[unknown]
CDS:CBG13248d	CBG13248d		[unknown]
CDS:CBG13248e	CBG13248e		[unknown]
CDS:CBG13248f	CBG13248f		[unknown]

0 RNAi Result

1 Allele

• cbp40196

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068962
• Remark: Cbr-crh-1, TGTCTTGAAAATCGTGTATCGGTGCTGGAAAACCAGAATAAGGCATTGATCGAAGAGCTG, WBGene00034037
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region