WormMine: Gene WBGene00034083

• WormBase Gene ID: WBGene00034083
• Gene Name: Cbr-taf-12
• Sequence Name: CBG13304
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein heterodimerization activity. Predicted to be involved in DNA-templated transcription initiation. Predicted to be part of SAGA complex and transcription factor TFIID complex. Is an ortholog of C. elegans taf-12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13304b.1	CBG13304b.1		[unknown]
Transcript:CBG13304a.1	CBG13304a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13304a	CBG13304a		[unknown]
CDS:CBG13304b	CBG13304b		[unknown]

0 RNAi Result

18 Allele

• WBVar00119509
• WBVar00119507
• WBVar00119508
• WBVar00119505
• WBVar00119506
• WBVar00119514
• WBVar00119515
• WBVar00119512
• WBVar00119513
• WBVar00119510
• WBVar00119511
• WBVar00119503
• WBVar00119504
• WBVar00119518
• WBVar00119519
• WBVar00119516
• WBVar00119517
• WBVar00119520

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060482
• Remark: Cbr-taf-12, ACCTCTCAAAGGAAAAGCATTTGCCAACAGAGGCTCATAAGCAACGAGTCGCTCTGCTGA, WBGene00034083
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region