WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034091 Gene Name  CBG13312
Sequence Name  ? CBG13312 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in fatty acid biosynthetic process. Is an ortholog of C. elegans Y56A3A.19. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13312.1 CBG13312.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13312 CBG13312   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13312, GCTTCAAAACTCCACGCGACATCTTCCAGTACATCGCCGACAAGGAAGATGTTTTTGAAT, WBGene00034091   Expr1056290 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region