WormMine: Gene WBGene00034094

• WormBase Gene ID: WBGene00034094
• Gene Name: CBG13315
• Sequence Name: CBG13315
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleic acid binding activity and poly(A)-specific ribonuclease activity. Predicted to be part of CCR4-NOT complex. Is an ortholog of C. elegans ccf-1. In C. elegans, ccf-1 is involved in nuclear-transcribed mRNA poly(A) tail shortening and oogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13315.1	CBG13315.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13315	CBG13315		[unknown]

0 RNAi Result

74 Allele

• WBVar00137685
• WBVar00137687
• WBVar00137686
• WBVar00137689
• WBVar00137688
• WBVar00137690
• WBVar00137691
• WBVar00119561
• WBVar00119562
• WBVar00119560
• WBVar00119569
• WBVar00119567
• WBVar00119568
• WBVar00119565
• WBVar00119566
• WBVar00119563
• WBVar00119564
• WBVar00119509
• WBVar00119507
• WBVar00119508
• WBVar00119505
• WBVar00119506
• WBVar00119514
• WBVar00119515
• WBVar00119512
• WBVar00119513
• WBVar00119510
• WBVar00119511
• WBVar00119503
• WBVar00119504

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051892
• Remark: CBG13315, ATCAAGAAGCAGTTTTTCGGAGATAGCTGGAATCAAATTGCTCCTCTGATTTGCGGTCAC, WBGene00034094
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region