WormMine: Gene WBGene00034117

• WormBase Gene ID: WBGene00034117
• Gene Name: Cbr-gpcp-2
• Sequence Name: CBG13338
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphoric diester hydrolase activity and starch binding activity. Predicted to be involved in lipid metabolic process. Is an ortholog of C. elegans gpcp-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13338b.1	CBG13338b.1		[unknown]
Transcript:CBG13338a.1	CBG13338a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13338a	CBG13338a		[unknown]
CDS:CBG13338b	CBG13338b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059055
• Remark: CBG13338, ACAGAATTGGAGAGGAGGAACGCCGTCGTAACGTCTTCATCGTTGAAAGAGAGCAGAAGC, WBGene00034117
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region