WormMine: Gene WBGene00034153

• WormBase Gene ID: WBGene00034153
• Gene Name: Cbr-let-268
• Sequence Name: CBG13377
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen. Is an ortholog of C. elegans let-268. In C. elegans, let-268 is involved in collagen biosynthetic process and protein glycosylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13377.1	CBG13377.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13377	CBG13377		[unknown]

0 RNAi Result

9 Allele

• WBVar00137692
• WBVar00137694
• WBVar00137693
• WBVar00137695
• WBVar00119658
• WBVar00119659
• WBVar00119660
• WBVar00119661
• WBVar00119662

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061150
• Remark: Cbr-let-268, GAAGGTCTCGCCACGACAAAGGGTACCAGATATATTATGGTGTCGTTTATCAATCCATAA, WBGene00034153
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region