WormMine: Gene WBGene00034222

• WormBase Gene ID: WBGene00034222
• Gene Name: Cbr-puf-1.2
• Sequence Name: CBG13460
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans fbf-1 and fbf-2. In C. elegans, fbf-1 is involved in several processes, including germline cell cycle switching, mitotic to meiotic cell cycle; olfactory learning; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13460.1	CBG13460.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13460	CBG13460		[unknown]

0 RNAi Result

4 Allele

• WBVar00137704
• WBVar00137706
• WBVar00137705
• WBVar00119843

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr11516
• Pattern: The developmental profiles of Cbr-puf-2 and Cbr-puf-1.2 mRNA levels are qualitatively similar and are typical of germ line-expressed genes: low expression from embryo to L2 stages, slightly increasing expression at L3 and L4, and peak levels in adults. However, Cbr-puf-2 is over 100-fold more abundant than Cbr-puf-1.2.

• Primary Identifier: Expr1053940
• Remark: CBG13460, ACATCATCGAATCGCCTGGCATCCTTGACAACTACCGTAACACCATCATTGAGCAATGCC, WBGene00034222
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region