WormMine: Gene WBGene00034231

• WormBase Gene ID: WBGene00034231
• Gene Name: Cbr-hlh-1
• Sequence Name: CBG13470
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein dimerization activity. Predicted to be involved in muscle organ development and regulation of DNA-templated transcription. Is an ortholog of C. elegans hlh-1. In C. elegans, hlh-1 is involved in positive regulation of mesodermal cell fate specification; positive regulation of transcription by RNA polymerase II; and striated muscle cell differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13470b.1	CBG13470b.1		[unknown]
Transcript:CBG13470c.1	CBG13470c.1		[unknown]
Transcript:CBG13470d.1	CBG13470d.1		[unknown]
Transcript:CBG13470e.1	CBG13470e.1		[unknown]
Transcript:CBG13470f.1	CBG13470f.1		[unknown]
Transcript:CBG13470a.1	CBG13470a.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13470d	CBG13470d		[unknown]
CDS:CBG13470c	CBG13470c		[unknown]
CDS:CBG13470f	CBG13470f		[unknown]
CDS:CBG13470e	CBG13470e		[unknown]
CDS:CBG13470b	CBG13470b		[unknown]
CDS:CBG13470a	CBG13470a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058468
• Remark: Cbr-hlh-1, ATGGACCAGAACCATCATTTGCAAATGACACAACCGATTAGTGCCGCACCACATGATTAT, WBGene00034231
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region