WormMine: Gene WBGene00034243

• WormBase Gene ID: WBGene00034243
• Gene Name: Cbr-vps-18
• Sequence Name: CBG13485
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Is an ortholog of C. elegans vps-18. In C. elegans, vps-18 is involved in endosome organization and phagosome-lysosome fusion involved in apoptotic cell clearance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13485.2	CBG13485.2		[unknown]
Transcript:CBG13485.1	CBG13485.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13485	CBG13485		[unknown]

0 RNAi Result

10 Allele

• WBVar00137724
• WBVar00137726
• WBVar00137725
• WBVar00137728
• WBVar00137727
• WBVar00137729
• WBVar00137731
• WBVar00137730
• WBVar00137733
• WBVar00137732

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051941
• Remark: CBG13485, GAGCCGGATGCGTTGGAAATGGTGCTCAGGAAACAGGCGGATTTTTATATAAGGGAGAAG, WBGene00034243
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region