WormMine: Gene WBGene00034361

• WormBase Gene ID: WBGene00034361
• Gene Name: Cbr-taf-1
• Sequence Name: CBG13620
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA polymerase II general transcription initiation factor activity; TBP-class protein binding activity; and histone acetyltransferase activity. Predicted to be involved in transcription by RNA polymerase II. Predicted to be part of transcription factor TFIID complex. Is an ortholog of C. elegans taf-1. In C. elegans, taf-1 is involved in embryo development and transcription initiation at RNA polymerase II promoter.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13620.1	CBG13620.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13620	CBG13620		[unknown]

0 RNAi Result

15 Allele

• WBVar00120143
• WBVar00120140
• WBVar00120141
• WBVar00120142
• WBVar00120132
• WBVar00120133
• WBVar00120134
• WBVar00120135
• WBVar00120136
• WBVar00120137
• WBVar00120138
• WBVar00120139
• WBVar00120130
• WBVar00120131
• WBVar00120129

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051568
• Remark: Cbr-taf-1, CTCAAGGATATGCGTTTGATTCTGGACAATTCGTTGGCGTTCAATGGAGAAGCTAGTATC, WBGene00034361
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region