WormMine: Gene WBGene00034371

• WormBase Gene ID: WBGene00034371
• Gene Name: Cbr-lin-15B
• Sequence Name: CBG13631
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in negative regulation of vulval development. Is an ortholog of C. elegans lin-15B. In C. elegans, lin-15B is involved in negative regulation of Ras protein signal transduction; negative regulation of vulval development; and regulation of cell fate specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13631.1	CBG13631.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13631	CBG13631		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053672
• Remark: Cbr-lin-15B, TCAATGTCCCAAGTGCTACCAGCTATCATCTCCCTCAAAGGATACATCACCACCAACAAT, WBGene00034371
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region