WormMine: Gene WBGene00034452

• WormBase Gene ID: WBGene00034452
• Gene Name: CBG13738
• Sequence Name: CBG13738
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cysteine-type peptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans Y40H7A.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13738.1	CBG13738.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13738	CBG13738		[unknown]

0 RNAi Result

9 Allele

• WBVar00137900
• WBVar00137902
• WBVar00137901
• WBVar00137903
• WBVar00137898
• WBVar00137897
• WBVar00137899
• WBVar00137896
• WBVar00137895

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1050513
• Remark: CBG13738, TGCTCTAATTGTGATTGGATACGGACCAGATTATTGGATTTTGAAGAACACCTACAGTAA, WBGene00034452
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region