WormMine: Gene WBGene00034479

• WormBase Gene ID: WBGene00034479
• Gene Name: Cbr-fcd-2
• Sequence Name: CBG13770
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in DNA repair. Is an ortholog of C. elegans fcd-2. In C. elegans, fcd-2 is involved in nucleotide-excision repair and regulation of DNA-templated DNA replication.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13770.1	CBG13770.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13770	CBG13770		[unknown]

0 RNAi Result

26 Allele

• WBVar00046619
• WBVar00017024
• WBVar00017019
• WBVar00017014
• WBVar00017009
• WBVar00017004
• WBVar00017044
• WBVar00017049
• WBVar00017034
• WBVar00017039
• WBVar00017029
• WBVar00120315
• WBVar00120316
• WBVar00120317
• WBVar00120318
• WBVar00120319
• WBVar00120320
• WBVar00120321
• WBVar00120322
• WBVar00120323
• WBVar00120324
• WBVar00016999
• WBVar00016994
• WBVar00016989
• WBVar00016984
• WBVar00016979

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1055675
• Remark: Cbr-fcd-2, GAAGAGCAGATCCATCGACGGAGAGATTATCACGAATCAACCGGACAGTCCAATGGATTC, WBGene00034479
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region