WormMine: Gene WBGene00034747

• WormBase Gene ID: WBGene00034747
• Gene Name: Cbr-rgl-1
• Sequence Name: CBG14158
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in small GTPase-mediated signal transduction. Is an ortholog of C. elegans rgl-1. In C. elegans, rgl-1 is involved in epidermal growth factor receptor signaling pathway and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14158d.1	CBG14158d.1		[unknown]
Transcript:CBG14158a.1	CBG14158a.1		[unknown]
Transcript:CBG14158b.1	CBG14158b.1		[unknown]
Transcript:CBG14158c.1	CBG14158c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14158b	CBG14158b		[unknown]
CDS:CBG14158a	CBG14158a		[unknown]
CDS:CBG14158d	CBG14158d		[unknown]
CDS:CBG14158c	CBG14158c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059241
• Remark: Cbr-rgl-1, CCACAAAATTCCTTTTATTTGGCTAGAGTTGGACTGGATGATGACCTCCAAAATACTGAT, WBGene00034747
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region