WormMine: Gene WBGene00034763

• WormBase Gene ID: WBGene00034763
• Gene Name: Cbr-ddr-2
• Sequence Name: CBG14186
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine kinase activity. Is an ortholog of C. elegans ddr-2. In C. elegans, ddr-2 is involved in interneuron axon guidance; motor neuron axon guidance; and positive regulation of axon regeneration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14186.1	CBG14186.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14186	CBG14186		[unknown]

0 RNAi Result

22 Allele

• WBVar00002159
• WBVar00002149
• WBVar00002154
• WBVar00002139
• WBVar00002144
• WBVar00002124
• WBVar00002129
• WBVar00002134
• WBVar00002119
• WBVar00121050
• WBVar00121051
• WBVar00121052
• WBVar00121053
• WBVar00121054
• WBVar00121055
• WBVar00121045
• WBVar00121046
• WBVar00121047
• WBVar00121048
• WBVar00121049
• WBVar00029214
• WBVar00029209

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053654
• Remark: Cbr-ddr-2, GAATGTGTCCAGCCAAACTGTACACTGAGCAAATGCTGCCTTGCTGGAACTACGATAGCA, WBGene00034763
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region