WormMine: Gene WBGene00034824

• WormBase Gene ID: WBGene00034824
• Gene Name: Cbr-tsp-17
• Sequence Name: CBG14269
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans tsp-17. In C. elegans, tsp-17 is involved in cellular response to paraquat; negative regulation of response to oxidative stress; and regulation of dopamine uptake involved in synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14269a.1	CBG14269a.1		[unknown]
Transcript:CBG14269b.1	CBG14269b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14269b	CBG14269b		[unknown]
CDS:CBG14269a	CBG14269a		[unknown]

0 RNAi Result

6 Allele

• WBVar00121176
• WBVar00121180
• WBVar00121177
• WBVar00121178
• WBVar00121179
• WBVar00029324

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060418
• Remark: Cbr-tsp-17, CTTTCATGTTGCCTAATCTCTCGCATTCACATCTACCATGTCATTCCAGAAGATTATTAG, WBGene00034824
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region