WormMine: Gene WBGene00034834

• WormBase Gene ID: WBGene00034834
• Gene Name: CBG14281
• Sequence Name: CBG14281
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable flavin-dependent sulfhydryl oxidase activity. Is an ortholog of C. elegans F47B7.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14281a.1	CBG14281a.1		[unknown]
Transcript:CBG14281b.1	CBG14281b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14281b	CBG14281b		[unknown]
CDS:CBG14281a	CBG14281a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1064648
• Remark: CBG14281, CGGAGTGGCGCTGATCGTTGTCTACTGCAAATACCGGAAGAACAGATCAAAGTTTTGGAA, WBGene00034834
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region