WormMine: Gene WBGene00034889

• WormBase Gene ID: WBGene00034889
• Gene Name: Cbr-vha-12
• Sequence Name: CBG14362
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in ATP metabolic process and proton transmembrane transport. Predicted to be part of proton-transporting V-type ATPase, V1 domain. Is an ortholog of C. elegans vha-12. In C. elegans, vha-12 is involved in several processes, including positive regulation of apoptotic process involved in development; positive regulation of neurotransmitter secretion; and regulation of intracellular pH.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14362a.1	CBG14362a.1		[unknown]
Transcript:CBG14362b.1	CBG14362b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14362b	CBG14362b		[unknown]
CDS:CBG14362a	CBG14362a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1065454
• Remark: Cbr-vha-12, AAGCGTATCCCAGCGAAATCACTCGATAAGTACTACCCACGTGGTGGAGCCAAGGAATAA, WBGene00034889
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region