WormMine: Gene WBGene00034910

• WormBase Gene ID: WBGene00034910
• Gene Name: Cbr-paf-2
• Sequence Name: CBG14389
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 1-alkyl-2-acetylglycerophosphocholine esterase activity. Is an ortholog of C. elegans paf-2. In C. elegans, paf-2 is involved in lipid catabolic process and morphogenesis of embryonic epithelium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14389.1	CBG14389.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14389	CBG14389		[unknown]

0 RNAi Result

26 Allele

• WBVar00138098
• WBVar00121270
• WBVar00121271
• WBVar00121272
• WBVar00121273
• WBVar00121274
• WBVar00121275
• WBVar00121265
• WBVar00121266
• WBVar00121267
• WBVar00121268
• WBVar00121269
• WBVar00121260
• WBVar00121261
• WBVar00121262
• WBVar00121263
• WBVar00121264
• WBVar00121257
• WBVar00121258
• WBVar00121259
• WBVar00121276
• WBVar00121277
• WBVar00121278
• WBVar00029564
• WBVar00029569
• WBVar00029559

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061664
• Remark: Cbr-paf-2, AGAATGTGTCAAAGCTCTCAATGTCTTGGAGCAACTGAATCTTGGAACTGTTCCTGAGAA, WBGene00034910
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region