WormMine: Gene WBGene00034940

• WormBase Gene ID: WBGene00034940
• Gene Name: CBG14447
• Sequence Name: CBG14447
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans tbx-35. In C. elegans, tbx-35 is involved in cell fate specification; chordate pharyngeal muscle development; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14447.1	CBG14447.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14447	CBG14447		[unknown]

0 RNAi Result

6 Allele

• WBVar00017567
• WBVar00121321
• WBVar00121322
• WBVar00121323
• WBVar00121324
• WBVar00121325

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059201
• Remark: CBG14447, CTCCCTCTTGTACAGGATCTTCAGAAGACATTTCAAATCAATATGATTCTGCTGTAGCAG, WBGene00034940
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region