WormMine: Gene WBGene00034955

• WormBase Gene ID: WBGene00034955
• Gene Name: Cbr-ncr-1
• Sequence Name: CBG14473
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans ncr-1. In C. elegans, ncr-1 is involved in several processes, including cholesterol homeostasis; positive regulation of growth rate; and regulation of egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14473a.1	CBG14473a.1		[unknown]
Transcript:CBG14473b.1	CBG14473b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14473b	CBG14473b		[unknown]
CDS:CBG14473a	CBG14473a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1064065
• Remark: Cbr-ncr-1, GTAATGTCTTCTGGAATTCTCATCGAGTTCTCTGTGAATGTTCTGAAAGGATACGCTTGC, WBGene00034955
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region