WormMine: Gene WBGene00034959

• WormBase Gene ID: WBGene00034959
• Gene Name: CBG14483
• Sequence Name: CBG14483
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatidylinositol binding activity and ubiquitin binding activity. Is an ortholog of C. elegans C07A12.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14483c.1	CBG14483c.1		[unknown]
Transcript:CBG14483b.1	CBG14483b.1		[unknown]
Transcript:CBG14483a.1	CBG14483a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14483c	CBG14483c		[unknown]
CDS:CBG14483b	CBG14483b		[unknown]
CDS:CBG14483a	CBG14483a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1057567
• Remark: CBG14483, AAACTCGGATCAACTGACCAAGTTGCGTACCGATCTTGACGTCGTCAACCAGAACATCAA, WBGene00034959
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region