WormMine: Gene WBGene00035044

• WormBase Gene ID: WBGene00035044
• Gene Name: Cbr-ets-5
• Sequence Name: CBG14604
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity and sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans ets-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14604c.1	CBG14604c.1		[unknown]
Transcript:CBG14604a.1	CBG14604a.1		[unknown]
Transcript:CBG14604b.1	CBG14604b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14604c	CBG14604c		[unknown]
CDS:CBG14604b	CBG14604b		[unknown]
CDS:CBG14604a	CBG14604a		[unknown]

0 RNAi Result

10 Allele

• WBVar00121540
• WBVar00121541
• WBVar00121542
• WBVar00121543
• WBVar00121544
• WBVar00121545
• WBVar00121546
• WBVar00121547
• WBVar00121538
• WBVar00121539

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052708
• Remark: Cbr-ets-5, ATCCAATCGGCTGTTCAATCGCTGTCACCATACACGAATCGTACGCGTTGGTTTTTCTAA, WBGene00035044
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region