WormMine: Gene WBGene00035105

• WormBase Gene ID: WBGene00035105
• Gene Name: Cbr-pks-1
• Sequence Name: CBG14683
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable acyltransferase activity and phosphopantetheine binding activity. Predicted to be involved in biosynthetic process. Is an ortholog of C. elegans pks-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14683a.1	CBG14683a.1		[unknown]
Transcript:CBG14683b.1	CBG14683b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14683a	CBG14683a		[unknown]
CDS:CBG14683b	CBG14683b		[unknown]

0 RNAi Result

13 Allele

• WBVar00121590
• WBVar00121584
• WBVar00121585
• WBVar00121586
• WBVar00121587
• WBVar00121588
• WBVar00121589
• WBVar00121580
• WBVar00121581
• WBVar00121582
• WBVar00121583
• WBVar00121578
• WBVar00121579

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061902
• Remark: CBG14683, GAGGTATTCTCAAAGTTCAAGGAATTTCACTGGCTCGCGGATACTTTTCTTCTAATCCTA, WBGene00035105
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region